Garretttyre1972 Garretttyre1972

02-04-2018
Mathematics

contestada

What is the area of Figure ABCD?
answer choices are A:54 B:60 C:66 D:72

What is the area of Figure ABCD answer choices are A54 B60 C66 D72 class=

Respuesta :

fsutyre fsutyre

02-04-2018

C is the answer or 66

Answer Link

Otras preguntas

If the area of a square is 32 ft2, how long is its diagonal?

Isabelle has been forgetting a lot of things lately, and her friends and family have been angry with her. Today, she feels as if she's going to do something wr

The substance in the digestive system that lubricates moistens and protects the surface of the lumen is

Explain the translation process that results in production of a polypeptide

20% of what number is equal to 2/3 of 90?

A pp plant is making gametes. how many types of gametes, and in what proportions, will there be

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Differences between body composition- risk for heart disease or chronic disease.

CAN SOMEONE HELP ME PLEASE ?

You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per