CreativeCookies CreativeCookies

01-03-2018
French

contestada

Can someone please help?

Answer the question in a complete French sentence:

Combien coûtent tes chaussures?

Respuesta :

kayahutsman kayahutsman

01-03-2018

How much does your shoes cost?

Answer Link

sharonkayesupak sharonkayesupak

01-03-2018

thats how much are the shoes

Answer Link

Otras preguntas

which of the following is a difference between the blinded stage and the inaction stage of organizational decline?

What type of angle is angle M? A. Acute B. Right C. Straight D. Obtuse

im tired of being alive and im giving up soon. im just having some fun on here but its time to go soon

Place the correct punctuation after each sentence. Indicate whether the sentence is declarative, interrogative, exclamatory,or imperative. Why do the people ima

100 Points Math Question 1). The main show tank has a radius of 70 feet and forms a quarter sphere where the bottom of the pool is spherical and the top of the

How is solving a - ab = c for a different from the problems in this lesson? How might you solve this equation for a?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

how many days are shellfish tags required to be kept on site?

why was europa so easily taken away

In a list of seven consecutive numbers a quarter of the smallest number is five less than a third of the largest number. If x is the smallest number, find expre