aalexander92 aalexander92
  • 01-09-2017
  • Business
contestada

What is sales quota?

Respuesta :

jekskskskssksk jekskskskssksk
  • 01-09-2017
A sales quota is a target sales reps are set for a specific period (month, quarter, year). Sales quotas can be set in dollar figures or in the number of goods or services sold.
Answer Link

Otras preguntas

What kind of problems did increased urbanization cause? During time of industrial revolution
is a centimeter one tenth or one hundredth or a meter
What is the additive inverse of -4a
Give a recursive algorithm for finding the sum of the first n odd positive integers.
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What was George Washington's nickname?