hudsonca2018 hudsonca2018

02-03-2015
Biology

contestada

what is the longest stage of the cell cycle called

Respuesta :

secret13 secret13

02-03-2015

Do you mean mitosis?
Interphase > Prophase > Metaphase > Anaphase > Telophase

Interphase takes the longest of all..

Answer Link

aleberry55 aleberry55

02-03-2015

Interphase is the first and longest stage of the cell cycle.

Answer Link

Otras preguntas

2. What are some hazards that require the closure of an operation?

who is the new nikolas cassadine on general hospital

Solve ∣−2−1∣=11 where do i start

Photo above need help

One small airplane has 44 seats. The flight crew sits in two of these seats. The remaining seats are divided equally into 7 rows for passengers. Explain how you

How do characters in both this excerpt from “The Perfect Storm” and “The Birds” employ science and technology to deal with a natural threat?

PLSSSSS HELP!!!!! Write the equation of a line that is perpendicular to the given line and that passes through the given point. y- 4 = (x+3); (-7,8) O A. y-8 =

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

where does columbus state he is being ordered to go

Guys please help this is due in a few hours and i’m panicking