d9ekarkat2mch d9ekarkat2mch
  • 03-03-2017
  • Chemistry
contestada

How much energy is needed to completely remove an electron from n $ 2 in a hydrogen atom?

Respuesta :

Аноним Аноним
  • 17-03-2017
the energy needed to split an atom into separate protons, neutrons, and electrons
Answer Link

Otras preguntas

what was paul revere failures
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
What Role Does the Sun Play in Producing Winds And Ocean Currents
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
Tu as quels cours le jeudi matin?
The section of the small intestine between the duodenum and ilium?