EstonQ636008 EstonQ636008
  • 03-11-2022
  • Mathematics
contestada

Draw the line of reflection. Give the equation for the line of reflection.

Draw the line of reflection Give the equation for the line of reflection class=

Respuesta :

JazzlynnH341585 JazzlynnH341585
  • 03-11-2022

The given figure shows two triangles reflected horizontally.}

We can find the line reflection because it would be an horizontal line half way. Remember that horizontal lines have the form y = k, where k = 1 in this case,

Hence, the line of reflection is y = 1.

Answer Link

Otras preguntas

The Panama Canal connects what two bodies of water?
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
the perimeter of a square 116ft ?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Fossils are most commonly found in which type of rock?
how do i find the angles on a kite?
what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
Please help with Algebra 1
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
what is the percent change from 70 to 56?