Jadenpoulson43 Jadenpoulson43
  • 01-04-2022
  • Mathematics
contestada

Can you help me with this

Can you help me with this class=

Respuesta :

ESLearner ESLearner
  • 01-04-2022

In the case of multiplication in exponents, if the numbers are the same, their exponents are added.

7 + 8 is written to the power of x, and 3 + 2 is written to the power of y.

Answer Link

Otras preguntas

Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
What is the additive inverse of -4a
Is 5/7 greater than 4/6
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?