guest0911 guest0911

02-01-2017
Mathematics

contestada

use the numbers on the tiles to write the differences. then write the next fact pattern

Respuesta :

kathere2learn kathere2learn

03-01-2017

was there more information to this question? doesn't make sense

Answer Link

Otras preguntas

Caleb solved this equation and recorded his work. 7.4x + 4.1(2x − 4) = −2.3(x − 6) − 21.6 1. 7.4x + 8.2x − 16.4 = −2.3x + 13.8 − 21.6 2. 15.6x − 16.4 = −2.3x

A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?

1. Find the missing side length. A. 12 in B. 15 in C. 17 in D. 21 in 2. Find the missing side length. A. 25 m B. 20 m C. 75 m D. 100 m

With increasing doses of any useful drug there is usually an increase in the number and severity of

Monocytes are a type of white blood cell that can differentiate into what two cells?

The small organs used by spiders to produce silk are called _____________. silk nozzles spinnerets pedipalps mouthparts

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

paul has a standard deck of cards. what is the probability he will choose a 2?

*The sum of two numbers is 400. If the first number is decreased by 20% and the second number is decreased by 15%, then the sum would be 68 less. Find the numbe

what does the liver do in the excretory system