SoloSoldier SoloSoldier
  • 02-10-2021
  • Mathematics
contestada

Do I use LCM or HCF? And how can I decide which to use? (Brainliest if you can answer the whole thing)

Do I use LCM or HCF And how can I decide which to use Brainliest if you can answer the whole thing class=

Respuesta :

SarimHussain7
SarimHussain7 SarimHussain7
  • 02-10-2021

Answer:

As far as i know you should go for LCM that would be more convenient and easy to do

Answer Link

Otras preguntas

Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
when Jefferson took office he did what
what are 2 examples of ionic compound?
p(x) x^3+x^2-x-1 Find all zeros of p (x)
Graph the first six terms of a sequence where a1 = -10 and d = 3.
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October