100026877kberry
100026877kberry 100026877kberry
  • 02-12-2016
  • Mathematics
contestada

what is the answer to this problem

what is the answer to this problem class=

Respuesta :

beastmodew beastmodew
  • 02-12-2016
3:5 my answer has to be 20 characters so im just typing the rest of this to answer your question.
Answer Link
Аноним Аноним
  • 02-12-2016
it would be 3:8.

hope this helps you
Answer Link

Otras preguntas

How to change 3 7/8 into an improper fraction
who fought against each other in the crusades?
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
how do you know 8 thousandths is less than 1 hundredths
i need help with this question
Write expression using the distributive property to find the product of 7 times 63
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?