zoegabriellamcginnis zoegabriellamcginnis

02-03-2021
Mathematics

contestada

f+1/7=5? What is does the f stand for . Also explain.

Respuesta :

XxCottoncandyXx194 XxCottoncandyXx194

02-03-2021

Answer:

dcijkchb dhcdnhujkcmnjic jni

Step-by-step explanation:

uducjkv

Answer Link

antoniobrioli antoniobrioli

02-03-2021

Answer:

4 6/7

Step-by-step explanation:

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Groups that are more formal and require less continuous interaction are known as what type of group?

What is the area of this composed figure

What law required Northerners to assist in the return of runaway slaves

Groups that are more formal and require less continuous interaction are known as what type of group?

(50)points 5 questions

the height h in feet of a projectile launched upward at a speed of 32 feet/ second from a height of 48 feet is given by the function : h(t) =16^2+32t +48. how l

Using the images or terms, describe how parts of a cell interact to export proteins.

how did white supremacists provide support for the ku klux klan

what is the sum of odd positive integers less than 50