Markchi
Markchi Markchi
  • 04-02-2021
  • Mathematics
contestada

Please help me, I will MARK AS BRAINLIEST.

Please help me I will MARK AS BRAINLIEST class=

Respuesta :

santibp82
santibp82 santibp82
  • 04-02-2021

Answer:

The third one

Step-by-step explanation:

Answer Link

Otras preguntas

Phillip advised his clients they needed to paint their master bedroom before showing the property. the walls of this room were 11' high. the wall lengths were 1
Los deportistas profesionales ____ el pago por si desempeño. recibe reciben reciban reciba
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
If o- can give to every other blood type, why cant it recieve other blood types
Raquel recently received a poor grade on a school assignment. Her mother has noticed that Raquel is staying up late at night and hides in her room. Raquel is re
what is 3/5 of 21? plz answer the question
Can you give me a short summary (only in 1 or 2 sentences) on Shakespeare’s Macbeth. And what it is.
Which aspect of communist economies kept them from matching the production efficiency and quality of free market economies
For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile
Which phrase best describes the New World Order?