Susiery Susiery

01-04-2020
Mathematics

contestada

Is (-8,-2) a solution to the systems of equations? X-4y=2
5x-8y=-6

Respuesta :

tiarriclose19 tiarriclose19

02-04-2020

Answer:

Step-by-step explanation:

It is 4 /6)7)2\€{

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Renaissance painters in flanders as in italy tended to produce work that was

Choose all that apply. Melinda finds that she does not like taking risks with her money. Which of the following would you recommend for her? Collectibles stock

Which statements describe instances of harassment rather than bullying? Check all that apply. Chen is often ridiculed because he is Asian. Kaylee is often teas

help plz asap !!!!!!!!!!

Differences between body composition- risk for heart disease or chronic disease.

which item below is part of the circulatory system a. kidneysb. lungsc. heart or d. stomach

Why did North Carolina and South Carolina split into two colonies? A. They had different beliefs about slavery. B. They had large groups of competin

Aerial photographs most often are taken from __________. A. aircrafts B. hot air balloons C. satellites D. space shuttles

Berlin laughs uncontrollably in where have you gone charming billy because he finds billys death