Tayblux9453 Tayblux9453
  • 02-01-2020
  • History
contestada

Which statement identifies the central idea of the text? for the death marches in the holocaust

Respuesta :

nalleitenw
nalleitenw nalleitenw
  • 02-01-2020

The Death Marches were periods of time when prisoners were sent to march off to the next concentration camp they were assigned to

They were shot

Answer Link

Otras preguntas

if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What does hemostasis mean?
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
Give a recursive algorithm for finding the sum of the first n odd positive integers.
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
is a centimeter one tenth or one hundredth or a meter
Please help me with this two step math problem! THANK YOU !!!!!!!!
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr