ouuve17 ouuve17

02-09-2019
Mathematics

contestada

What is the probability of drawing a blue marble?

3/7
70%
1/3
3/10

What is the probability of drawing a blue marble 37 70 13 310 class=

Respuesta :

MathPhys MathPhys

02-09-2019

Answer:

3/10

Step-by-step explanation:

There are 20 marbles. 6 of them are blue.

P = 6/20 = 3/10

Answer Link

BALLER2711 BALLER2711

02-09-2019

The answer will be 3/10

Answer Link

Otras preguntas

How are logos, pathos, and ethos I used in an argument

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

WILL MARK THE BRAINIEST!!!!! A biologist just found a new organism living in the deep ocean and is unsure whether or not to classify it as an animal. Describe t

Marco is building a house. he bought lots of wood to make the frame of the house. he wants right angles for his corners. if he uses a piece of wood that is cut

what is 3/5 of 21? plz answer the question

A man has blood type AB and his wife has blood type B. What are the possible blood types for their child

The long-reigning absolutist king of france, __________, portrayed himself as the "sun king."

N the world's lowest-income nations, two in ten children born die by the age of

What did Theodore Roosevelt do before he was elected president at the age of 42?

I really need help! 25 points and I'll give brainliest. Thanks! 1. Describe the main events and leaders of the Punic Wars. 2. Write a short paragraph that di